Review



guide rna sequence targeting 5  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Addgene inc guide rna sequence targeting 5
    Guide Rna Sequence Targeting 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/guide rna sequence targeting 5/product/Addgene inc
    Average 90 stars, based on 5 article reviews
    guide rna sequence targeting 5 - by Bioz Stars, 2026-03
    90/100 stars

    Images



    Similar Products

    90
    GenScript corporation pdx1 guide rna (grna) sequence (5′-aag gag gag gac aag aag cg-3′)
    The mutations of Pancreatic and duodenal homeobox 1 ( <t>Pdx1</t> ) result in varying degrees of absence in both the endocrine and exocrine cells of the axolotl pancreas, attributable to different allele mutations. (A) Schematic diagrams of the Pdx1 gene structure and PDX1 protein domains, along with a schematic illustration of the actual effects of Pdx1 mutations on the proteins. CRISPR gRNAs was designed to target the Pdx1 sequence and injected into one-cell-stage eggs, and resulted in mild and severe phenotypes. Axolotls with a complete homeobox in both Pdx1 alleles ( Pdx1 s/s ) exhibit a severe phenotype. In contrast, a mismatch or frameshift mutation in the homeobox region of both Pdx1 alleles ( Pdx1 m/m ) results in a milder pancreatic defect. (B) Fasting blood glucose levels in control, heterozygous, and homozygous axolotls show that blood glucose significantly increase in Pdx1 −/− mutants, while no significant change is observed in Pdx1 +/− mutants. (C–E) Anatomical analysis of control (C) and Pdx1 mutant axolotls (blue circle). A complete pancreatic structure, but with a small portion of the pancreas body missing (D) . While a severe phenotype is characterized by the development of only a remnant of pancreatic head (E) . (F) In situ hybridization for Amy (blue) on cryosections shows that Pdx1 mutants causes a deficiency in the exocrine pancreas. (G) Immunofluorescence for INS (red), GCG (green), combined with DAPI (blue) on cryosections shows INS + /GCG + double hormone cells (arrows) appear in Pdx1 m/m mutant axolotls, while Pdx1 s/s mutant axolotls have no endocrine cells. (H) Statistical analysis of endocrine cell counts shows a decrease in the number of β, α, and δ cells following Pdx1 mutations. (I) Statistical analysis of the proportions of β, α, and δ cells in the control, Pdx1 m/m , and Pdx1 s/s groups. (J) Statistical analysis of double hormone cells in the control and Pdx1 m/m groups. (K) Statistical analysis shows that animal growth is severely inhibited in Pdx1 s/s mutant axolotls. Data are the mean ± s. e.m. Scale bar: (C–E) 200 μm; (F) 200 μm; (G) 50 μm.
    Pdx1 Guide Rna (Grna) Sequence (5′ Aag Gag Gag Gac Aag Aag Cg 3′), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pdx1 guide rna (grna) sequence (5′-aag gag gag gac aag aag cg-3′)/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    pdx1 guide rna (grna) sequence (5′-aag gag gag gac aag aag cg-3′) - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Benchling Inc single guide rnas for hif1a (sequence 5′-gatggtaagcctcatcacag-3′)
    Stable knockout of <t>HIF1A</t> in Caco-2 cells leads to decreased HIF1α signaling upon pathway activation. (A) Time-dependent HIF1α responsive element (HRE)-luciferase assay over 48 h treatment with 1 mM DMOG. Gene expression levels of (B) HIF1A and the HIF1α pathway targets (C) PGK1 , (D) EGLN3 , and (E) IL18 in Caco-2- HIF1A -null and control cells treated with 1 or 5 mM DMOG for 24 h. Data presented as mean ± SD. All experiments were performed with n = 3; * p < 0.05, ** p < 0.01, **** p < 0.0001.
    Single Guide Rnas For Hif1a (Sequence 5′ Gatggtaagcctcatcacag 3′), supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single guide rnas for hif1a (sequence 5′-gatggtaagcctcatcacag-3′)/product/Benchling Inc
    Average 90 stars, based on 1 article reviews
    single guide rnas for hif1a (sequence 5′-gatggtaagcctcatcacag-3′) - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    86
    Danaher Inc guide g rna sequence 5 caccgaggaggcgc tcttggtcag
    Stable knockout of <t>HIF1A</t> in Caco-2 cells leads to decreased HIF1α signaling upon pathway activation. (A) Time-dependent HIF1α responsive element (HRE)-luciferase assay over 48 h treatment with 1 mM DMOG. Gene expression levels of (B) HIF1A and the HIF1α pathway targets (C) PGK1 , (D) EGLN3 , and (E) IL18 in Caco-2- HIF1A -null and control cells treated with 1 or 5 mM DMOG for 24 h. Data presented as mean ± SD. All experiments were performed with n = 3; * p < 0.05, ** p < 0.01, **** p < 0.0001.
    Guide G Rna Sequence 5 Caccgaggaggcgc Tcttggtcag, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/guide g rna sequence 5 caccgaggaggcgc tcttggtcag/product/Danaher Inc
    Average 86 stars, based on 1 article reviews
    guide g rna sequence 5 caccgaggaggcgc tcttggtcag - by Bioz Stars, 2026-03
    86/100 stars
      Buy from Supplier

    90
    Thermo Fisher prom1 synthetic guide rna (grna) sequence (5’–cgttgctgcaacaaatgcgg–3)
    Stable knockout of <t>HIF1A</t> in Caco-2 cells leads to decreased HIF1α signaling upon pathway activation. (A) Time-dependent HIF1α responsive element (HRE)-luciferase assay over 48 h treatment with 1 mM DMOG. Gene expression levels of (B) HIF1A and the HIF1α pathway targets (C) PGK1 , (D) EGLN3 , and (E) IL18 in Caco-2- HIF1A -null and control cells treated with 1 or 5 mM DMOG for 24 h. Data presented as mean ± SD. All experiments were performed with n = 3; * p < 0.05, ** p < 0.01, **** p < 0.0001.
    Prom1 Synthetic Guide Rna (Grna) Sequence (5’–Cgttgctgcaacaaatgcgg–3), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/prom1 synthetic guide rna (grna) sequence (5’–cgttgctgcaacaaatgcgg–3)/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    prom1 synthetic guide rna (grna) sequence (5’–cgttgctgcaacaaatgcgg–3) - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Addgene inc guide rna sequence targeting 5
    Stable knockout of <t>HIF1A</t> in Caco-2 cells leads to decreased HIF1α signaling upon pathway activation. (A) Time-dependent HIF1α responsive element (HRE)-luciferase assay over 48 h treatment with 1 mM DMOG. Gene expression levels of (B) HIF1A and the HIF1α pathway targets (C) PGK1 , (D) EGLN3 , and (E) IL18 in Caco-2- HIF1A -null and control cells treated with 1 or 5 mM DMOG for 24 h. Data presented as mean ± SD. All experiments were performed with n = 3; * p < 0.05, ** p < 0.01, **** p < 0.0001.
    Guide Rna Sequence Targeting 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/guide rna sequence targeting 5/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    guide rna sequence targeting 5 - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    96
    Addgene inc single guide rna sgrna target sequence 5 caccggtacacggtgaactcgtgcg
    Stable knockout of <t>HIF1A</t> in Caco-2 cells leads to decreased HIF1α signaling upon pathway activation. (A) Time-dependent HIF1α responsive element (HRE)-luciferase assay over 48 h treatment with 1 mM DMOG. Gene expression levels of (B) HIF1A and the HIF1α pathway targets (C) PGK1 , (D) EGLN3 , and (E) IL18 in Caco-2- HIF1A -null and control cells treated with 1 or 5 mM DMOG for 24 h. Data presented as mean ± SD. All experiments were performed with n = 3; * p < 0.05, ** p < 0.01, **** p < 0.0001.
    Single Guide Rna Sgrna Target Sequence 5 Caccggtacacggtgaactcgtgcg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single guide rna sgrna target sequence 5 caccggtacacggtgaactcgtgcg/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    single guide rna sgrna target sequence 5 caccggtacacggtgaactcgtgcg - by Bioz Stars, 2026-03
    96/100 stars
      Buy from Supplier

    94
    Addgene inc guide rna sequence 5
    Stable knockout of <t>HIF1A</t> in Caco-2 cells leads to decreased HIF1α signaling upon pathway activation. (A) Time-dependent HIF1α responsive element (HRE)-luciferase assay over 48 h treatment with 1 mM DMOG. Gene expression levels of (B) HIF1A and the HIF1α pathway targets (C) PGK1 , (D) EGLN3 , and (E) IL18 in Caco-2- HIF1A -null and control cells treated with 1 or 5 mM DMOG for 24 h. Data presented as mean ± SD. All experiments were performed with n = 3; * p < 0.05, ** p < 0.01, **** p < 0.0001.
    Guide Rna Sequence 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/guide rna sequence 5/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    guide rna sequence 5 - by Bioz Stars, 2026-03
    94/100 stars
      Buy from Supplier

    93
    Addgene inc single guide rna sequence 5 ccccggacgatattgaacaa tgg
    Stable knockout of <t>HIF1A</t> in Caco-2 cells leads to decreased HIF1α signaling upon pathway activation. (A) Time-dependent HIF1α responsive element (HRE)-luciferase assay over 48 h treatment with 1 mM DMOG. Gene expression levels of (B) HIF1A and the HIF1α pathway targets (C) PGK1 , (D) EGLN3 , and (E) IL18 in Caco-2- HIF1A -null and control cells treated with 1 or 5 mM DMOG for 24 h. Data presented as mean ± SD. All experiments were performed with n = 3; * p < 0.05, ** p < 0.01, **** p < 0.0001.
    Single Guide Rna Sequence 5 Ccccggacgatattgaacaa Tgg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single guide rna sequence 5 ccccggacgatattgaacaa tgg/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    single guide rna sequence 5 ccccggacgatattgaacaa tgg - by Bioz Stars, 2026-03
    93/100 stars
      Buy from Supplier

    90
    Sangon Biotech si-hit000218960 guide rna oligo sequences, 5'-accgaacuuucgccgauucug-3
    Stable knockout of <t>HIF1A</t> in Caco-2 cells leads to decreased HIF1α signaling upon pathway activation. (A) Time-dependent HIF1α responsive element (HRE)-luciferase assay over 48 h treatment with 1 mM DMOG. Gene expression levels of (B) HIF1A and the HIF1α pathway targets (C) PGK1 , (D) EGLN3 , and (E) IL18 in Caco-2- HIF1A -null and control cells treated with 1 or 5 mM DMOG for 24 h. Data presented as mean ± SD. All experiments were performed with n = 3; * p < 0.05, ** p < 0.01, **** p < 0.0001.
    Si Hit000218960 Guide Rna Oligo Sequences, 5' Accgaacuuucgccgauucug 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/si-hit000218960 guide rna oligo sequences, 5'-accgaacuuucgccgauucug-3/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    si-hit000218960 guide rna oligo sequences, 5'-accgaacuuucgccgauucug-3 - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Sangon Biotech si-hmga2 guide rna oligo sequences, 5'-ucuuuagcuauauuuucugca-3
    Stable knockout of <t>HIF1A</t> in Caco-2 cells leads to decreased HIF1α signaling upon pathway activation. (A) Time-dependent HIF1α responsive element (HRE)-luciferase assay over 48 h treatment with 1 mM DMOG. Gene expression levels of (B) HIF1A and the HIF1α pathway targets (C) PGK1 , (D) EGLN3 , and (E) IL18 in Caco-2- HIF1A -null and control cells treated with 1 or 5 mM DMOG for 24 h. Data presented as mean ± SD. All experiments were performed with n = 3; * p < 0.05, ** p < 0.01, **** p < 0.0001.
    Si Hmga2 Guide Rna Oligo Sequences, 5' Ucuuuagcuauauuuucugca 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/si-hmga2 guide rna oligo sequences, 5'-ucuuuagcuauauuuucugca-3/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    si-hmga2 guide rna oligo sequences, 5'-ucuuuagcuauauuuucugca-3 - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    Image Search Results


    The mutations of Pancreatic and duodenal homeobox 1 ( Pdx1 ) result in varying degrees of absence in both the endocrine and exocrine cells of the axolotl pancreas, attributable to different allele mutations. (A) Schematic diagrams of the Pdx1 gene structure and PDX1 protein domains, along with a schematic illustration of the actual effects of Pdx1 mutations on the proteins. CRISPR gRNAs was designed to target the Pdx1 sequence and injected into one-cell-stage eggs, and resulted in mild and severe phenotypes. Axolotls with a complete homeobox in both Pdx1 alleles ( Pdx1 s/s ) exhibit a severe phenotype. In contrast, a mismatch or frameshift mutation in the homeobox region of both Pdx1 alleles ( Pdx1 m/m ) results in a milder pancreatic defect. (B) Fasting blood glucose levels in control, heterozygous, and homozygous axolotls show that blood glucose significantly increase in Pdx1 −/− mutants, while no significant change is observed in Pdx1 +/− mutants. (C–E) Anatomical analysis of control (C) and Pdx1 mutant axolotls (blue circle). A complete pancreatic structure, but with a small portion of the pancreas body missing (D) . While a severe phenotype is characterized by the development of only a remnant of pancreatic head (E) . (F) In situ hybridization for Amy (blue) on cryosections shows that Pdx1 mutants causes a deficiency in the exocrine pancreas. (G) Immunofluorescence for INS (red), GCG (green), combined with DAPI (blue) on cryosections shows INS + /GCG + double hormone cells (arrows) appear in Pdx1 m/m mutant axolotls, while Pdx1 s/s mutant axolotls have no endocrine cells. (H) Statistical analysis of endocrine cell counts shows a decrease in the number of β, α, and δ cells following Pdx1 mutations. (I) Statistical analysis of the proportions of β, α, and δ cells in the control, Pdx1 m/m , and Pdx1 s/s groups. (J) Statistical analysis of double hormone cells in the control and Pdx1 m/m groups. (K) Statistical analysis shows that animal growth is severely inhibited in Pdx1 s/s mutant axolotls. Data are the mean ± s. e.m. Scale bar: (C–E) 200 μm; (F) 200 μm; (G) 50 μm.

    Journal: Frontiers in Cell and Developmental Biology

    Article Title: Revealing the biological features of the axolotl pancreas as a new research model

    doi: 10.3389/fcell.2025.1531903

    Figure Lengend Snippet: The mutations of Pancreatic and duodenal homeobox 1 ( Pdx1 ) result in varying degrees of absence in both the endocrine and exocrine cells of the axolotl pancreas, attributable to different allele mutations. (A) Schematic diagrams of the Pdx1 gene structure and PDX1 protein domains, along with a schematic illustration of the actual effects of Pdx1 mutations on the proteins. CRISPR gRNAs was designed to target the Pdx1 sequence and injected into one-cell-stage eggs, and resulted in mild and severe phenotypes. Axolotls with a complete homeobox in both Pdx1 alleles ( Pdx1 s/s ) exhibit a severe phenotype. In contrast, a mismatch or frameshift mutation in the homeobox region of both Pdx1 alleles ( Pdx1 m/m ) results in a milder pancreatic defect. (B) Fasting blood glucose levels in control, heterozygous, and homozygous axolotls show that blood glucose significantly increase in Pdx1 −/− mutants, while no significant change is observed in Pdx1 +/− mutants. (C–E) Anatomical analysis of control (C) and Pdx1 mutant axolotls (blue circle). A complete pancreatic structure, but with a small portion of the pancreas body missing (D) . While a severe phenotype is characterized by the development of only a remnant of pancreatic head (E) . (F) In situ hybridization for Amy (blue) on cryosections shows that Pdx1 mutants causes a deficiency in the exocrine pancreas. (G) Immunofluorescence for INS (red), GCG (green), combined with DAPI (blue) on cryosections shows INS + /GCG + double hormone cells (arrows) appear in Pdx1 m/m mutant axolotls, while Pdx1 s/s mutant axolotls have no endocrine cells. (H) Statistical analysis of endocrine cell counts shows a decrease in the number of β, α, and δ cells following Pdx1 mutations. (I) Statistical analysis of the proportions of β, α, and δ cells in the control, Pdx1 m/m , and Pdx1 s/s groups. (J) Statistical analysis of double hormone cells in the control and Pdx1 m/m groups. (K) Statistical analysis shows that animal growth is severely inhibited in Pdx1 s/s mutant axolotls. Data are the mean ± s. e.m. Scale bar: (C–E) 200 μm; (F) 200 μm; (G) 50 μm.

    Article Snippet: The Pdx1 guide RNA (gRNA) sequence (5′-AAG GAG GAG GAC AAG AAG CG-3′) was synthesized by GenScript.

    Techniques: CRISPR, Sequencing, Injection, Mutagenesis, Control, In Situ Hybridization, Immunofluorescence

    Stable knockout of HIF1A in Caco-2 cells leads to decreased HIF1α signaling upon pathway activation. (A) Time-dependent HIF1α responsive element (HRE)-luciferase assay over 48 h treatment with 1 mM DMOG. Gene expression levels of (B) HIF1A and the HIF1α pathway targets (C) PGK1 , (D) EGLN3 , and (E) IL18 in Caco-2- HIF1A -null and control cells treated with 1 or 5 mM DMOG for 24 h. Data presented as mean ± SD. All experiments were performed with n = 3; * p < 0.05, ** p < 0.01, **** p < 0.0001.

    Journal: Frontiers in Microbiology

    Article Title: Faecalibacterium prausnitzii promotes intestinal epithelial IL-18 production through activation of the HIF1α pathway

    doi: 10.3389/fmicb.2023.1298304

    Figure Lengend Snippet: Stable knockout of HIF1A in Caco-2 cells leads to decreased HIF1α signaling upon pathway activation. (A) Time-dependent HIF1α responsive element (HRE)-luciferase assay over 48 h treatment with 1 mM DMOG. Gene expression levels of (B) HIF1A and the HIF1α pathway targets (C) PGK1 , (D) EGLN3 , and (E) IL18 in Caco-2- HIF1A -null and control cells treated with 1 or 5 mM DMOG for 24 h. Data presented as mean ± SD. All experiments were performed with n = 3; * p < 0.05, ** p < 0.01, **** p < 0.0001.

    Article Snippet: Single guide RNAs for HIF1A (sequence 5′-GATGGTAAGCCTCATCACAG-3′) were designed via Benchling © online platform ( https://www.benchling.com/ ) and cloned in pLenti-sgRNA backbone (Addgene, 71409).

    Techniques: Knock-Out, Activation Assay, Luciferase, Expressing

    Differential gene expression (DGE) analysis of Caco-2- HIF1A -null upon coculture with F. prausnitzii , compared to Caco-2 empty vector controls. (A) Schematic representation of the HoxBan coculture system, including experiment layout. Caco-2- HIF1A -null cells, or appropriate control (iCas9 empty vector), were cultured in the HoxBan system for 18 h in the absence or presence of F. prausnitzii inoculum (in figure, mono and co, respectively). Volcano plots showing differential gene expression analysis comparing Caco-2- HIF1A -null cells and Caco-2-empty vector in monoculture ( B ; purple and pink dots represent downregulated and upregulated genes, respectively) and coculture with F. prausnitzii ( C ; green and blue dots represent downregulated and upregulated genes, respectively). All dots display significant observations with p < 0.05. Veen diagrams were used to discover uniquely (D) upregulated and (E) downregulated DGE (numbers underlined inside blue and green diagrams, respectively) in Caco-2- HIF1A -null cultured with F. prausnitzii , compared to Caco-2-empty vector in same condition. All experiments performed in n = 3.

    Journal: Frontiers in Microbiology

    Article Title: Faecalibacterium prausnitzii promotes intestinal epithelial IL-18 production through activation of the HIF1α pathway

    doi: 10.3389/fmicb.2023.1298304

    Figure Lengend Snippet: Differential gene expression (DGE) analysis of Caco-2- HIF1A -null upon coculture with F. prausnitzii , compared to Caco-2 empty vector controls. (A) Schematic representation of the HoxBan coculture system, including experiment layout. Caco-2- HIF1A -null cells, or appropriate control (iCas9 empty vector), were cultured in the HoxBan system for 18 h in the absence or presence of F. prausnitzii inoculum (in figure, mono and co, respectively). Volcano plots showing differential gene expression analysis comparing Caco-2- HIF1A -null cells and Caco-2-empty vector in monoculture ( B ; purple and pink dots represent downregulated and upregulated genes, respectively) and coculture with F. prausnitzii ( C ; green and blue dots represent downregulated and upregulated genes, respectively). All dots display significant observations with p < 0.05. Veen diagrams were used to discover uniquely (D) upregulated and (E) downregulated DGE (numbers underlined inside blue and green diagrams, respectively) in Caco-2- HIF1A -null cultured with F. prausnitzii , compared to Caco-2-empty vector in same condition. All experiments performed in n = 3.

    Article Snippet: Single guide RNAs for HIF1A (sequence 5′-GATGGTAAGCCTCATCACAG-3′) were designed via Benchling © online platform ( https://www.benchling.com/ ) and cloned in pLenti-sgRNA backbone (Addgene, 71409).

    Techniques: Expressing, Plasmid Preparation, Cell Culture

    Uniquely upregulated genes in F. prausnitzii -cocultured Caco-2-  HIF1A  -null cells, compared to F. prausnitzii -cocultured Caco-2 control cells.

    Journal: Frontiers in Microbiology

    Article Title: Faecalibacterium prausnitzii promotes intestinal epithelial IL-18 production through activation of the HIF1α pathway

    doi: 10.3389/fmicb.2023.1298304

    Figure Lengend Snippet: Uniquely upregulated genes in F. prausnitzii -cocultured Caco-2- HIF1A -null cells, compared to F. prausnitzii -cocultured Caco-2 control cells.

    Article Snippet: Single guide RNAs for HIF1A (sequence 5′-GATGGTAAGCCTCATCACAG-3′) were designed via Benchling © online platform ( https://www.benchling.com/ ) and cloned in pLenti-sgRNA backbone (Addgene, 71409).

    Techniques:

    Uniquely downregulated genes in F. prausnitzii -cocultured Caco-2-  HIF1A  -null cells, compared to F. prausnitzii -cocultured Caco-2 control cells.

    Journal: Frontiers in Microbiology

    Article Title: Faecalibacterium prausnitzii promotes intestinal epithelial IL-18 production through activation of the HIF1α pathway

    doi: 10.3389/fmicb.2023.1298304

    Figure Lengend Snippet: Uniquely downregulated genes in F. prausnitzii -cocultured Caco-2- HIF1A -null cells, compared to F. prausnitzii -cocultured Caco-2 control cells.

    Article Snippet: Single guide RNAs for HIF1A (sequence 5′-GATGGTAAGCCTCATCACAG-3′) were designed via Benchling © online platform ( https://www.benchling.com/ ) and cloned in pLenti-sgRNA backbone (Addgene, 71409).

    Techniques:

    RNA sequencing analysis reveals that HIF1A ablation prevents upregulation of IL18 by F. prausnitzii in intestinal epithelial cells. (A,B) HIF1α and HIF2α scores shows a decrease in HIF1α, but not HIF2α, activation capacity in Caco-2- HIF1A -null, compared to Caco-2-empty vector control in coculture with F. prausnitzii . (C) Normalized gene expression counts of IL18 in Caco-2- HIF1A -null cells, compared to Caco-2-empty vector in monoculture and coculture with F. prausnitzii . (D) Spearman correlation analysis between IL18 gene expression and HIF1α scores on Caco-2 cells in the HoxBan system. All experiments performed in n = 3 (ns = not significant, ** p < 0.001 and *** p < 0.0001).

    Journal: Frontiers in Microbiology

    Article Title: Faecalibacterium prausnitzii promotes intestinal epithelial IL-18 production through activation of the HIF1α pathway

    doi: 10.3389/fmicb.2023.1298304

    Figure Lengend Snippet: RNA sequencing analysis reveals that HIF1A ablation prevents upregulation of IL18 by F. prausnitzii in intestinal epithelial cells. (A,B) HIF1α and HIF2α scores shows a decrease in HIF1α, but not HIF2α, activation capacity in Caco-2- HIF1A -null, compared to Caco-2-empty vector control in coculture with F. prausnitzii . (C) Normalized gene expression counts of IL18 in Caco-2- HIF1A -null cells, compared to Caco-2-empty vector in monoculture and coculture with F. prausnitzii . (D) Spearman correlation analysis between IL18 gene expression and HIF1α scores on Caco-2 cells in the HoxBan system. All experiments performed in n = 3 (ns = not significant, ** p < 0.001 and *** p < 0.0001).

    Article Snippet: Single guide RNAs for HIF1A (sequence 5′-GATGGTAAGCCTCATCACAG-3′) were designed via Benchling © online platform ( https://www.benchling.com/ ) and cloned in pLenti-sgRNA backbone (Addgene, 71409).

    Techniques: RNA Sequencing Assay, Activation Assay, Plasmid Preparation, Expressing